Skip to main content

Advertisement

Table 1 Sequences of primers for real-time quantitative PCR

From: Calendula officinalis stimulate proliferation of mouse embryonic fibroblasts via expression of growth factors TGFβ1 and bFGF

Gene Primer Product size Tm
HPRT Sense:CCTCCTCAGACCGCTTTTT 91 79.5
Antisense:AACCTGGTTCATCATCGCTAA
FGF2 Sense: AACGGCGGCTTCTTCCTG 133 78.9
Antisense:TGGCACACACTCCCTTGATAG
TGFβ1 Sense: ATTCCTGGCGTTACCTTGG 117 76.9
Antisense:CCTGTATTCCGTCTCCTTGG