Skip to main content

Advertisement

Table 1 List of primer sets and universal probes for quantitative real-time PCR.

From: Effects of acute exposure to low-dose radiation on the characteristics of human bone marrow mesenchymal stromal/stem cells

Gene Forward primer (5′–3′) Reverse primer (5′–3′) Universal probe (#)
Ang-1 gacagatgttgagacccaggta tgcttctctagcttgtaggtgga 67
Flt3L ggccgaaatgacagtgct agcagcaggaggagataggtt 1
GAPDH agccacatcgctcagacac gcccaatacgaccaaatcc 60
IL-6 gatgagtacaaaagtcctgatcca ctgcagccactggttctgt 40
Jag-1 ggcaacaccttcaacctca gcctccacaagcaacgtatag 28
LIF tgccaatgccctctttattc gtccaggttgttggggaac 26
SCF gcgctgcctttccttatg ccttcagttttgacgagagga 68
FABP4 ccaccataaagagaaaacgagag gtggaagtgacgcctttcat 77
Runx2 ctaccaccccgctgtcttc aaaaagggcccagttctga 4
  1. Ang-1 angiopoietin-1, Flt3L fms-related tyrosine kinase 3 ligand, GAPDH glyceraldehyde-3-phosphate dehydrogenase, IL-6 interleukin-6, Jag-1 jagged-1, LIF leukemia inhibitory factor, SCF stem cell factor, FABP4 fatty acid-binding protein 4, Runx2 runt-related transcription factor 2