Skip to content

Advertisement

  • Research article
  • Open Access

Calendula officinalis stimulate proliferation of mouse embryonic fibroblasts via expression of growth factors TGFβ1 and bFGF

  • 1, 2,
  • 3,
  • 4 and
  • 5Email author
Inflammation and Regeneration201939:7

https://doi.org/10.1186/s41232-019-0097-x

  • Received: 12 February 2019
  • Accepted: 8 April 2019
  • Published:

Abstract

Background

TGF-β has an important role in the process of wound healing and scar formation. The aim of this study is to determine the effects of ethanolic and methanolic extracts of Calendula officinalis on the expression of TGFβ1 and bFGF in the mouse embryonic fibroblast cells (MEFs).

Methods

Calendula officinalis extract was purchased and different substances defined with gas chromatography and mass spectrometry. MEFs were prepared and after incubating for 15 min, cell viability analyzed. TGF β 1 and bFGF gene expression was evaluated by real-time PCR. TGFβ1 and bFGF protein expression analyzed by ELISA. The statistical analysis of data was done by using SPSS software. Differences were considered significant at (P < 0.05).

Results

The results of the MTT test showed that the concentrations of 5 μg/ml and10 μg/ml were more suitable for cell proliferation. There was an increase in TGF β 1 gene expression in the MEFs. Expression of TGF β 1 gene remains the same after 24 h. Gene expression of bFGF showed a similar pattern with TGF β 1 expression for both solvents. Analysis of TGFβ1 protein expression showed an increase in TGFβ1 gene expression in the MEFs. Protein expression of bFGF in the MEFs increased at different concentrations at 12 and 24 h after treatment (P < 0.05 and P < 0.01 respectively).

Conclusion

Calendula officinalis stimulates proliferation of MEFs. Calendula via increased expression of growth factors (TGFβ1 and bFGF) at the first 12 h and a decrease of these factors at 24 h after treatment may ameliorate function of the MEFs in the during wound healing.

Keywords

  • Calendula officinalis
  • bFGF
  • TGFβ1
  • Mouse embryonic fibroblasts

Background

Growth of new tissue and scar formation are two important issues in tissue injury. Fibroblasts are the main cells in the wound healing process because they migrate and proliferate to the injury site after 2 or 3 days. Then, the cells produce extracellular matrix especially collagen. Growth factors play important roles in the proliferation, migration, and production of ECM substances by fibroblasts. Recently, researches showed that the growth factor TGF-β has an important role in the process not only in wound healing but also in scar formation. TGF-β applies their effects via the intracellular SMAD pathway. [1, 2]. It has been shown that TGFβ1 activates angiogenesis by stimulating vascular smooth muscle cell migration [35]. The importance of this factor in creating and maintaining the vascular system has been proved by numerous studies. TGFβ1 and its receptors lead to fetal death due to impaired vessel formation [6, 7]. TGFβ1 induces the maturation of retinoic acid-inducible gene I (RIGI), therefore, stimulates the formation and intensification of interaction between epithelial cells and the basement membrane of the mural cells [810]. Also bFGF, (FGF 2 or FGF-β) contribute to control of endothelial cells and fibroblasts migration, which are responsible for angiogenesis and collagen formation of the epithelial layer [1, 9, 11].

Calendula officinalis L. (Asteraceae) has been traditionally used in the treatment of various diseases such as skin tumors, dermatological lesions, and swellings. Despite a long tradition of use of Calendula officinalis L., the biological aspect of its activity has not been explored properly. Recent research supports the medicinal potential of Calendula officinalis L. Calendula officinalis L. properties need to be investigated to determine their varied biological activities and mechanism of actions. To determine the effectiveness of the Calendula officinalis L. in the treatment of dermatologic disorders, more research is necessary to understand the action mechanism of this plant. Therefore, the aim of this study is to determine the effect of the Calendula officinalis L. extract on proliferation and expression of two important growth factors, TGFβ1 and bFGF, at the MEFs.

Materials and methods

Preparation of Calendula officinalis extract

Twenty grams of dried flowers of Calendula officinalis were collected from Lorestan Agricultural and Natural Resources Research and Education Center and soaked in 120 ml of 50% ethanol or methanol for 72 h in a dark. In the next step, it was centrifuged and passed through the filter and dried at room temperature to yield 8.7% w/w extract. Then the extract was stored at − 20 °C until further use.

GC-MS analysis of Calendula officinalis extract

Different substances within Calendula officinalis extract defined with gas chromatography and mass spectrometry (GC-MS) at the Lorestan University.

Isolation and culture of MEFs

Isolation and culture of mouse embryonic fibroblasts (MEFs) were performed according to the protocol described elsewhere [12]. In the brief, a pregnant mouse at 13 or 14 days post-coitum (d.p.c) was sacrificed by dislocating of cervical vertebrae and uterine horns were dissected and rinsed in 70% (v/v) ethanol and placed into a Falcon tube with PBS buffer, without calcium and magnesium ions. The embryos were separated from its embryonic sac and placenta. Then, 1 ml of 0.05% trypsin/EDTA (Gibco, Invitrogen) containing 100 K units of DNase I per each embryo was added and incubated at the room temperature for 15 min. Cells were dissociated by pipetting each 5 min. Trypsin inactivated by the addition of 1 volume of freshly prepared MEF medium. Then, cells were centrifuged and the cell pellet was washed in warm MEF medium.

MTT assay

To evaluate cell viability, fibroblast cells incubated with different concentrations of Calendula officinalis (5 μg/ml, 10 μg/ml, 20 μg/ml, 40 μg/ml, and 50 μg/ml) for 12, 24, 48, and 72 h. Then, 20 μl of MTT (5 mg/ml, Sigma) in PBS solution added into each of the wells, and the plate was further incubated for 4 h. In the next step, 200 μl of DMSO added into each well, incubated for 15 min to dissolve the formed crystal formation and the light absorption measured using an enzyme-linked immunosorbent assay (ELISA) reader. Cell viability expressed as a percentage of absorbance values in treating cells.

Analysis of TGF β 1 and bFGF gene expression by real-time PCR

MEFs were exposed to different concentrations of ethanolic and methanolic Calendula officinalis extracts (5 μg/ml and 10 μg/ml) and then, cells were collected at 12 and 24 h using trypsin/EDTA. Total RNA isolated and the concentration and purity of RNA determined using biophotometer (Eppendorf, Hamburg, Germany). The concentration and quality of the RNA samples confirmed by electrophoresis on 1% denatured agarose gel.

Following procedures were performed:
  1. 1)

    Generation of first strand cDNA with 1 μg total RNA using the cDNA Synthesis Kit (Roche Diagnostics GmbH, Mannheim, Germany).

     
  2. 2)

    Selection of HPRT as the housekeeping gene.

     
  3. 3)

    Real-time quantitative PCR by using Rotor-Gene 6000 and SYBR-Green quantitative PCR (qPCR) kit (Jena Bioscience, Cat No. 311S)

     
Oligonucleotide sequences of the primers and their characteristics are presented in Table 1.
Table 1

Sequences of primers for real-time quantitative PCR

Gene

Primer

Product size

Tm

HPRT

Sense:CCTCCTCAGACCGCTTTTT

91

79.5

Antisense:AACCTGGTTCATCATCGCTAA

FGF2

Sense: AACGGCGGCTTCTTCCTG

133

78.9

Antisense:TGGCACACACTCCCTTGATAG

TGFβ1

Sense: ATTCCTGGCGTTACCTTGG

117

76.9

Antisense:CCTGTATTCCGTCTCCTTGG

Analysis of TGFβ1 and bFGF protein expression by ELISA

MEFs were cultured in 6-well plates (105 cell per well) and were exposed to ethanolic and methanolic extract of Calendula officinalis (5 μg/ml, 10 μg/ml) and supernatant were collected at 12 and 24 h. Samples were frozen at − 20 °C. TGF-β1 protein concentration in cell culture supernatants was measured by Ready-Set-GO TGF-β1 cytokine ELISA kit from eBioscience (San Diego, CA, USA, Catalog Number: 88-8350) and FGF ELISA kit (Cat no. ELH-bFGF-001; RayBiotech, Inc., St. Louis, MO).

Statistical analysis

The statistical analysis of data was done by using SPSS software. Differences between the groups were analyzed by using Wilcoxon test. Differences were considered significant at (P < 0.05).

Results

GC-MS analysis

GC-MS analysis showed that the main components present in the Calendula officinalis extract are carvacrol, thymol, ethyl hexadecanoate, and viridiflorene (Table 2).
Table 2

GC-MS analysis showed that the main components present in the Calendula officinalis extract are carvacrol, thymol, ethyl hexadecanoate, and viridiflorene

t’R(A)

RI(Calc)

RI(STD)

Similarity

Compound name

Area (%)

4.092

832.5714286

800

83%

Hexanal

1.005961

4.233

846

830

95%

Furfural

1.415797

4.375

859.5238095

851

92%

Furfuryl alcohol

1.453055

4.958

910.5333333

899

80%

Heptanal

1.19225

5.267

931.1333333

998

81%

Octanal

1.254347

5.933

975.5333333

957

94%

Furfural 5-methyl

1.20467

6.175

991.6666667

911

80%

Amyl acetate

3.551913

6.517

1010.432692

950

93%

Glycerin

19.54794

7.592

1062.115385

1112

80%

Heptyl acetate

2.707402

8.092

1086.153846

1106

77%

Maltol

1.800795

10.767

1185.402504

1171

70%

Umbellulone

0.384998

12.2

1230.191458

1228

85%

Citronellol

1.477894

14.433

1295.964654

1285

80%

Bornyl acetate

0.471932

14.642

1301.899736

1290

93%

Thymol

1.328862

14.967

1310.474934

1298

95%

Carvacrol

7.19076

19.658

1432.944162

1439

82%

Aromadendrene

0.422255

20.517

1454.746193

1458

87%

Beta Farnesene

0.981123

22.192

1497.258883

1467

83%

Caryophyllene

0.695479

22.467

1504.249364

1493

93%

Viridiflorene

3.154496

23.433

1528.829517

1524

91%

Delta Cadinene

1.043219

24.708

1561.272265

1549

90%

Elemol

0.34774

26.142

1597.760814

1600

90%

Hexadecane

0.471932

29.125

1674.806202

1658

80%

Eudesmol

2.309985

29.275

1678.682171

1691

80%

Juniper Camphor

0.471932

29.992

1697.209302

1700

87%

Heptadecane

0.397417

39.675

1967.424242

1959

90%

Hexadecanoic acid

0.894188

40.633

1996.454545

1993

93%

Ethyl hexadecanoate

0.558867

Effect of Calendula officinalis extract on MEFs viability

The results of MTT assay to determine if Calendula officinalis ethanolic/methanolic extract affects cell viability of MEFs at different concentration (5 μg/ml, 10 μg/ml, 20 μg/ml, 40 μg/ml) showed that the Calendula officinalis extract using both solvents was non-toxic to the cells. The concentrations of 5 μg/ml and10 μg/ml were more suitable for cell proliferation. Therefore, this study was evaluated in these concentrations (Fig. 1).
Fig. 1
Fig. 1

Effect of ethanolic (a) and methanolic (b) extract of Calendula on MEFs viability. Cells were treated with different concentration of Calendula for 12, 24, 48, and 72 h and cell viability was measured by MTT assay

TGF β 1 and bFGF gene expression

Analysis of TGF β 1 gene expression for the ethanolic extract (Fig. 2a) and the methanolic extract (Fig. 2b), revealed an increase TGF β 1 gene expression in the MEFs at different concentrations (5 μg/ml, 10 μg/ml) at 12 h after treatment (P < 0.05 and P < 0.01 respectively). But the expression of TGF β 1 gene remained the same 24 h at the two concentrations after treatment with ethanolic extract (Fig. 2a and Table 3). The methanolic extract results revealed an increase in the expression for the two extracts at 12 h and a decline in the expression of the gene at 24 h (Fig. 2b and Table 4) (P < 0.05 and P < 0.01 respectively). Gene expression of bFGF in the MEFs indicated a similar pattern with TGF β 1 expression for both solvent, an increase bFGF gene expression in the MEFs at different concentrations (5 μg/ml, 10 μg/ml) at 12 h after treatment (P < 0.05 and P < 0.01 respectively). But the expression of bFGF gene remained the same 24 h at the two concentrations after treatment with ethanolic extract (Fig. 3a and Table 5). The methanolic extract results indicated an increase in the expression for the two extracts at 12 h and a decline in the expression of the gene at 24 h (Fig. 3b and Table 6) (P < 0.05 and P < 0.01 respectively) (Table 2).
Fig. 2
Fig. 2

Relative expression of TGF β 1 gene in the MEFs that were treated with various concentrations of ethanol (a) and methanol (b) extracts of Calendula at different time intervals treatment (12 and 24 h). All comparisons were made compared to the control group. *P < 0.05, **P < 0.01. Abs gene reg: Absolute gene regulation

Table 3

The total expression ratio of the gene of TGFβ1 in the MEFs treated with various concentrations of ethanol extract of Calendula (5 and 10 μg/ml) relative to control group is presented in each time (12 and 24 h after treatment). The statistic test for significance is randomization re-allocation test, implemented in the relative expression software tool. Significant down or upregulations of the genes highlighted

 

12 h after treatment

24 h after treatment

5 μg/ml

10 μg/ml

5 μg/ml

10 μg/ml

Relative expression

1.7

2.3

0.7

0.62

Standard error

± 0.21

± 0.28

± 0.24

± 0.16

P value

0.235

0.001

0.490

0.359

Fold increase/decrease

+ 1.7

+ 2.3

− 1.4

− 1.6

Table 4

The total expression ratio of the gene of TGFβ1 in the MEFs treated with various concentrations of methanol extract of Calendula (5 and 10 μg/ml) relative to control group is presented in each time (12 and 24 h after treatment). The statistic test for significance is randomization re-allocation test, implemented in the relative expression software tool. Significant down or upregulations of the genes highlighted

 

12 h after treatment

24 h after treatment

5 μg/ml

10 μg/ml

5 μg/ml

10 μg/ml

Relative expression

1.3

2.1

0.7

0.62

Standard error

± 0.23

± 0.24

± 0.2

± 0.13

P value

0.265

0.001

0.661

0.001

Fold increase/decrease

+ 1.3

+ 2.1

− 1.06

− 2.5

Fig. 3
Fig. 3

Relative expression of bFGF gene in the MEFs that were treated with various concentrations of ethanol (a) and methanol (b) extracts of Calendula at different time intervals treatment (12 and 24 h). All comparisons were made compared to the control group. ٭P < 0.05, ٭٭P < 0.01. Abs gene reg: Absolute gene regulation

Table 5

The total expression ratio of the gene of bFGF in the MEFs treated with various concentration of ethanol extract of Calendula (5 and 10 μg/ml) relative to control group is presented in each time (12 and 24 h after treatment). The statistic test for significance is randomization re-allocation test, implemented in the relative expression software tool. Significant down or upregulations of the genes highlighted

 

12 h after treatment

24 h after treatment

5 μg/ml

10 μg/ml

5 μg/ml

10 μg/ml

Relative expression

1.9

2.2

0.42

0.39

Standard error

±0.24

±0.29

±0.19

±0.18

P- value

0.256

0.001

0.001

0.001

Fold increase/decrease

+ 1.9

+ 2.2

− 2.4

−2.5

Table 6

The total expression ratio of the gene of bFGF in the MEFs treated with various concentration of methanol extract of Calendula (5 and 10 μg/ml) relative to control group is presented in each time (12 and 24 h after treatment). The statistic test for significance is randomization re-allocation test, implemented in the relative expression software tool. Significant down or upregulations of the genes highlighted

 

12 h after treatment

24 h after treatment

5 μg/ml

10 μg/ml

5 μg/ml

10 μg/ml

Relative expression

1.5

2.1

0.52

0.34

Standard error

± 0.25

± 0.27

± 0.17

± 0.19

P value

0.231

0.001

0..275

0.001

Fold increase/decrease

+ 1.5

+ 2.1

− 1.9

− 2.96

TGFβ1 and bFGF protein expression

Analysis of TGFβ1 protein expression of the ethanolic extract (Fig. 4a) and the methanolic extract (Fig. 4b) revealed an increase TGFβ1 gene expression in the MEFs at different concentrations (5 μg/ml, 10 μg/ml) at 12 h (P < 0.05 and P < 0.01 respectively). But the expression of TGFβ1 protein was slightly reduced, 24 h at the two concentrations after treatment with ethanolic extract (Fig. 4a). The methanolic extract results indicated a similar pattern (Fig. 4b) (P < 0.05 and P < 0.01 respectively).
Fig. 4
Fig. 4

Effect of various concentrations of ethanol (a) and methanol (b) extracts of Calendula the expression of TGFβ1 protein in the MEFs culture supernatants. The MEFs were treated with different concentration of ethanol and methanol extracts of Calendula (5 and 10 μg/ml) at different time intervals treatment (12 and 24 h) and the expression of TGFβ1 protein was assessed by ELISA

Protein expression of bFGF in MEFs revealed an increase in bFGF protein expression at different concentrations (5 μg/ml, 10 μg/ml) of 12 h after treatment (P < 0.05 and P < 0.01 respectively). The same increasing pattern of bFGF protein expression was observed 24 h at the two concentrations after treatment with ethanolic extract. The methanolic extract results indicated a similar pattern with that of the ethanolic extract, as compared with the control (P < 0.05 and P < 0.01 respectively).

When the ethanolic and methanolic extracts of Calendula officinalis were compared, ethanolic extract indicated more effective to stimulate MEFs (Figs. 2, 3, and 4 and Tables 3, 4, 5, and 6).

Discussion

The results of the present study indicated that both methanol and ethanol extracts of Calendula officinalis had non-toxic effects of different concentration. The extracts similar to previous studies increased proliferation of the MEFs [13, 14]. Among different concentrations of Calendula extraction 5 and 10 μg/ml were more suitable for cell proliferation.

Previous investigation revealed that Calendula officinalis can inhibit collagen degradation and matrix metalloproteinase (MMP) activity, and induce neovascularization in the chorioallantoic membrane and skin wound.

Quercetin, one of the active components in Calendula, can decrease the expression of tumor necrosis factor-α (TNF-α), interleukin-1β, IL-6, and IL-8 [1417].

During the wound healing process, fibroblasts play a crucial role. Then, the cells proliferate and migrate into the wound area, synthesis extracellular matrix (EXM), and the express of thick actin bundles as myofibroblasts [18, 19].

Important cytokines that produce by fibroblast are TGFβ1 and bFGF. TGFβ1 and bFGF impacts on cell division, cell migration, cell differentiation, protein expression, and enzyme production and have the potential ability to heal wounds through stimulation of angiogenesis factors and cellular proliferation which affects the ECM production and degradation through their chemotactic role on inflammatory cells and fibroblasts [20].

Several studies indicated that upregulation of TGFβ1 can stimulate the production of fibrotic disease [21, 22].

In the present study, Calendula officinalis increased TGFβ1 and bFGF at the first 12 h therefore stimulate wound healing. Then, the decrease of these factors at 24 h suppressed the expression of TGFβ1 and bFGF and may inhibit the fibrotic process. The Calendula at first may upregulate the expression of TGFβ1 and bFGF but after that may downregulate the expression of these genes.

Conclusion

Calendula officinalis not only shows no cytotoxicity effects on MEFs but also stimulates proliferation of these cells. Calendula via increased expression of growth factors (TGFβ1 and bFGF) at the first 12 h, and a decrease of these factors at 24 h after treatment may ameliorate function of fibroblasts in the during wound healing.

Abbreviations

bFGF: 

Basic fibroblast growth factor

cDNA: 

Complementary deoxyribonucleic acid

DMEM: 

Dulbecco’s modified Eagle’s medium

ELISA: 

Enzyme-linked immunosorbent assay

FBS: 

Fetal bovine serum

HPRT: 

Hypoxanthine phosphoribosyltransferase

MEF: 

Mouse embryonic fibroblast

MTT: 

3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide

nm: 

Nanometer

PBS: 

Phosphate-buffered saline

Pg/ml: 

Picograms per milliliter

Real-time PCR: 

Real-time polymerase chain reaction

TGFβ1: 

Transforming growth factor β1

Tm: 

Melting temperature

TMB: 

3, 3′, 5, 5′-Tetramethylbenzidine

Declarations

Acknowledgements

This work was supported by Lorestan University of Medical Science, Khorramabad, Iran.

Funding

Not applicable.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors’ contributions

MH, AB, MRG, and AMG devised the study concept and design. MH and AB collected the data. MG and AMG drafted the manuscript. All authors have seen and approved the manuscript.

Ethics approval and consent to participate

All of the experimental manuals on animals were conducted with agreement of protocols of the laboratory animal care. These principles were approved by Animal Ethics Committee of Lorestan University of Medical Sciences.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Razi Herbal Medicine Research Center, Lorestan University of Medical Sciences, Khorramabad, Iran
(2)
Department of Biochemistry, Lorestan University of Medical Science, Khorramabad, Iran
(3)
Department of Anatomical Sciences, Kermanshah University of Medical Sciences, Kermanshah, Iran
(4)
Student Research Committee, Lorestan University of Medical Sciences, Khorramabad, Iran
(5)
Tissue Engineering and Stem Cells Research Center, Shahroud University of Medical Sciences, Shahroud, Iran

References

  1. Guo S, DiPietro LA. Factors affecting wound healing. J Dent Res. 2010;89(3):219–29.View ArticleGoogle Scholar
  2. Sadava EE, Krpata DM, Gao Y, Rosen MJ, Novitsky YW. Wound healing process and mediators: implications for modulations for hernia repair and mesh integration. J Biomed Mater Res A. 2014;102(1):295–302.View ArticleGoogle Scholar
  3. Atiba A, Nishimura M, Kakinuma S, Hiraoka T, Goryo M, Shimada Y, et al. Aloe vera oral administration accelerates acute radiation-delayed wound healing by stimulating transforming growth factor-β and fibroblast growth factor production. Am J Surg. 2011;201(6):809–18.View ArticleGoogle Scholar
  4. Ferrari G, Cook BD, Terushkin V, Pintucci G, Mignatti P. Transforming growth factor-beta 1 (TGF-β1) induces angiogenesis through vascular endothelial growth factor (VEGF)-mediated apoptosis. J Cell Physiol. 2009;219(2):449–58.View ArticleGoogle Scholar
  5. Ma J, Wang Q, Fei T, Han J-DJ, Chen Y-G. MCP-1 mediates TGF-β–induced angiogenesis by stimulating vascular smooth muscle cell migration. Blood. 2007;109(3):987–94.View ArticleGoogle Scholar
  6. Larsson J, Goumans MJ, Sjöstrand LJ, van Rooijen MA, Ward D, Levéen P, et al. Abnormal angiogenesis but intact hematopoietic potential in TGF-β type I receptor-deficient mice. EMBO J. 2001;20(7):1663–73.View ArticleGoogle Scholar
  7. Kim SI, Kwak JH, Na H-J, Kim JK, Ding Y, Choi ME. TGF-β1 activates TAK1 via TAB1-mediated autophosphorylation, independent of TGF-β receptor kinase activity in mesangial cells. J Biol Chem. 2009;284(33):22285–96.View ArticleGoogle Scholar
  8. Sánchez-Elsner T, Botella LM, Velasco B, Corbı́ A, Attisano L, Bernabéu C. Synergistic cooperation between hypoxia and transforming growth factor-β pathways on human vascular endothelial growth factor gene expression. J Biol Chem. 2001;276(42):38527–35.View ArticleGoogle Scholar
  9. Mason JC, Lidington EA, Ahmad SR, Haskard DO. bFGF and VEGF synergistically enhance endothelial cytoprotection via decay-accelerating factor induction. Am J Phys Cell Phys. 2002;282(3):C578–C87.View ArticleGoogle Scholar
  10. Ponce CC, Chauffaille MLLF, Ihara SSM, Silva MRR. Increased angiogenesis in primary myelofibrosis: latent transforming growth factor-β as a possible angiogenic factor. Rev Bras Hematol Hemoter. 2014;36(5):322–8.View ArticleGoogle Scholar
  11. Hom DB, Unger GM, Pernell KJ, Manivel JC. Improving surgical wound healing with basic fibroblast growth factor after radiation. Laryngoscope. 2005;115(3):412–22.View ArticleGoogle Scholar
  12. Jozefczuk J, Drews K, Adjaye J. Preparation of mouse embryonic fibroblast cells suitable for culturing human embryonic and induced pluripotent stem cells. J Vis Exp. 2012;(64). https://doi.org/10.3791/3854.
  13. Fronza M, Heinzmann B, Hamburger M, Laufer S, Merfort I. Determination of the wound healing effect of Calendula extracts using the scratch assay with 3T3 fibroblasts. J Ethnopharmacol. 2009;126(3):463–7.View ArticleGoogle Scholar
  14. Saini P, Al-Shibani N, Sun J, Zhang W, Song F, Gregson KS, et al. Effects of Calendula officinalis on human gingival fibroblasts. Homeopathy. 2012;101(2):92–8.View ArticleGoogle Scholar
  15. Min YD, Choi CH, Bark H, Son HY, Park HH, Lee S, et al. Quercetin inhibits expression of inflammatory cytokines through attenuation of NF-kappaB and p38 MAPK in HMC-1 human mast cell line. Inflamm Res. 2007;56(5):210–5.View ArticleGoogle Scholar
  16. Parente LM, Andrade MA, Brito LA, Moura VM, Miguel MP, Lino-Junior Rde S, et al. Angiogenic activity of Calendula officinalis flowers L. in rats. Acta Cir Bras. 2011;26(1):19–24.View ArticleGoogle Scholar
  17. Patrick K, Kumar S, Edwardson P, Hutchinson J. Induction of vascularisation by an aqueous extract of the flowers of Calendula officinalis L. the European marigold. Phytomedicine. 1996;3(1):11–8.View ArticleGoogle Scholar
  18. Gurtner GC, Werner S, Barrandon Y, Longaker MT. Wound repair and regeneration. Nature. 2008;453(7193):314–21.View ArticleGoogle Scholar
  19. Schafer M, Werner S. Transcriptional control of wound repair. Annu Rev Cell Dev Biol. 2007;23:69–92.View ArticleGoogle Scholar
  20. Ganapathy N, Venkataraman SS, Daniel R, Aravind RJ, Kumarakrishnan VB. Molecular biology of wound healing. J Pharm Bioallied Sci. 2012;4(Suppl 2):S334–7.View ArticleGoogle Scholar
  21. Isaka YTM, Ando Y, Nakamura H, Kaneda Y, Imai E, Hori M. Transforming growth factor-beta 1 antisense oligode-oxynucleotides block interstitial fibrosis in unilateral ureteral obstruction. Kidney Int. 2000;58:1885–92.View ArticleGoogle Scholar
  22. Song L, Tian Y, Xu Z-J, Zhang C-P. Adrenaline inhibited cell proliferation and regulated expression of TGF-beta1 and bFGF in cultured human hypertrophic scar fibroblasts via alpha-receptor. EXCLI J. 2008;7:1–12.Google Scholar

Copyright

© The Author(s) 2019

Advertisement